Review



biorad protein marker  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Bio-Rad biorad protein marker
    Biorad Protein Marker, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 3029 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/precision+plus+protein+dual+color+standards+biorad/Precision+Plus+Protein+Dual+Color+Standards/pm41376883-96-13-13
    Average 97 stars, based on 3029 article reviews
    biorad protein marker - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Enzyme-linked Immunosorbent Assay:

    Article Title: Vaccination of nonhuman primates elicits a broadly neutralizing antibody lineage targeting a quaternary epitope on the HIV-1 Env trimer.
    Article Snippet: In brief HIV-1 is highly prone to mutations, and a vaccine must stimulate production of antibodies targeting conserved determinants on its exposed envelope glycoprotein (Env).. Such broadly neutralizing antibodies (bNAbs) are infrequently induced by natural infection, but their elicitation by vaccination remains challenging.. Schleich et al. describe vaccine-elicited bNAbs in NHPs recognizing a quaternary epitope, defining a promising cross-conserved Env trimer target.

    Plasmid Preparation:

    Article Title: Vaccination of nonhuman primates elicits a broadly neutralizing antibody lineage targeting a quaternary epitope on the HIV-1 Env trimer.
    Article Snippet: In brief HIV-1 is highly prone to mutations, and a vaccine must stimulate production of antibodies targeting conserved determinants on its exposed envelope glycoprotein (Env).. Such broadly neutralizing antibodies (bNAbs) are infrequently induced by natural infection, but their elicitation by vaccination remains challenging.. Schleich et al. describe vaccine-elicited bNAbs in NHPs recognizing a quaternary epitope, defining a promising cross-conserved Env trimer target.

    Article Title: Bacteriophage protein PEIP is a potent Bacillus subtilis enolase inhibitor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5a Competent Cells Biomed Cat#BC102-02 E. coli BL21(DE3) Competent Cells Tsingke Cat#TSV-A09 B. subtilis Competent Cells This paper Stain 168 B. subtilis bacteriophage SPO1 BENA Cluture Collection ATCC27370-B1 Chemicals, peptides and recombinant proteins 23TSINGKE Master Mix(green) Tsingke Cat#TSE101 Plasmid Mini Kit Omega Cat#D6943-01 BeyoGel SDS-PAGE Precast Gel Beyotime Cat#P0057A 103TAE buffer Aladdin Cat#T197242 Agarose Biowest Cat#YZQZT Sorbitol Aladdin Cat#S104833 Trehalose Aladdin Cat#T100010 Mannitol Aladdin Cat#M108828 K2HPO4 Aladdin Cat#16788-57-1 KH2PO4 Aladdin Cat#7778-77-0 MgCl2 Aladdin Cat#7786-30-3 Threonine Solarbio Cat#T0012 Glycine Solarbio Cat#G8200 Tween80 Aladdin Cat#T104865 NaCl Aladdin Cat#C111549 Tryptone Aladdin Cat#T139519 Yeast extract Beyotime Cat#ST968 LB medium AOBOX Cat#02-136-y250g Chloramphenicol Aladdin Cat#C100331 Kanamycin Solarbio Cat#K8020 Ampicillin sodium Aladdin Cat#A102050 Glucose Aladdin Cat#921-60-8 Isopropyl-b-D-thiogalactoside Beyotime Cat#ST098 NaH2PO4 Aladdin Cat#7558-80-7 Imidazole Aladdin Cat#I108707 EDTA-Na2 Solarbio Cat#E8030 NiSO4$6H2O Sigma Cat#227676 Precision Plus Protein Dual Color Standards Biorad Cat1610374 53Protein loading buffer Sangon Biotech Cat#C515959-0005 Coomassie brilliant blue Beyotime Cat#P0017F .. Glutaraldehyde MercK Cat#354400 Osmic acid MercK Cat#209104 Uranyl acetate American Custom Chemicals Corporation Cat#CHM0032578 Ethanol MercK Cat#E7023 Acetone MercK Cat#179124 SUMO protease Ulp1 Abbkine Cat#PRP3001 His-tagged PEIP This paper N/A (Continued on next page) Cell Reports 40, 111026, July 5, 2022 e1

    Mutagenesis:

    Article Title: Vaccination of nonhuman primates elicits a broadly neutralizing antibody lineage targeting a quaternary epitope on the HIV-1 Env trimer.
    Article Snippet: In brief HIV-1 is highly prone to mutations, and a vaccine must stimulate production of antibodies targeting conserved determinants on its exposed envelope glycoprotein (Env).. Such broadly neutralizing antibodies (bNAbs) are infrequently induced by natural infection, but their elicitation by vaccination remains challenging.. Schleich et al. describe vaccine-elicited bNAbs in NHPs recognizing a quaternary epitope, defining a promising cross-conserved Env trimer target.

    Article Title: Evolving cryo-EM structural approaches for GPCR drug discovery.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Gs C-18 antibody Santa Cruz Cat# sc-383; RRID: AB_631539 mouse poly-His antibody QIAGEN Cat# 34660; RRID: AB_2619735 gp64-PE antibody Thermo Fisher Cat# 12-6991-82; RRID: AB_1633369 IRDye 680RD Goat anti-Mouse IgG LI-COR Cat# LCR-926-68070: RRID: AB_10956588 IRDye 800CW Goat anti-Rabbit IgG LI-COR Cat# LCR-925-32211: RRID: AB_2651127 Bacterial and virus strains Escherichia Coli BL21 ThermoFisher Cat# C600003 Chemicals, peptides, and recombinant proteins PF-06882961 Servier, France N/A ESF 921 serum-free media Expression Systems Cat# 96-001 Opti-MEM I Reduced Serum Medium Thermo Fisher Scientific Cat# 31985088 cOmplete Protease Inhibitor Cocktail tablets Roche Cat# 5056489001 Apyrase NEB Cat# M0398S Lauryl maltose neopentyl glycol Anatrace Cat# NG310 Cholesteryl hemisuccinate Anatrace Cat# CH210 Benzonase Merk Millipore Cat# 71205-3 Flag peptide Sigma-Aldrich Cat# F3290 M1 anti-Flag affinity resin Sigma-Aldrich Cat# A4596 Superdex 200 Increase 10/300 column GE Healthcare Cat# 28990944 Ni-NTA agarose Qiagen Cat# 30230 Anti-Flag M1 ATCC Hybridoma ATCC HB- 259;RRID:CVCL_J730 Amicon Ultra Centrifugal Filter (MWCO, 100 kDa) Merk Millipore UFC910024 TGX Precast Gel BioRad Cat#4561086 Precision Plus Protein Dual Color Standards BioRad Cat# 1610394 Instant Blue Sigma-Aldrich Cat# ISB1L PVDF membrane BioRad Cat# 1620264 FuGENE HD Transfection Reagent Promega Cat# E2311 Critical commercial assays Lance cAMP detection kit PerkinElmer Cat# AD0264 QuikChange site-directed mutagenesis kit Agilent Cat# 200521 Bac to Bac system ThermoFisher Cat# A11098 NanoBRET Nano-Glo substrate Promega Cat#N1572 Coelenterazine H NanoLight Cat#301 Fluo-8 AM Green Fluorescent Calcium binding dye Abcam Cat#142773 Deposited data 200 kV Glacios coordinates This manuscript PDB: 7LCK 200 kV Glacios maps This manuscript EMDB: EMD-23276 300 kV Titan Krios Falcon 4 coordinates This manuscript PDB: 7LCJ 300 kV Titan Krios Falcon 4 maps This manuscript EMDB: EMD-23275 (Continued on next page) Structure 29, 963–974.e1–e6, September 2, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER 300 kV Titan Krios K3 coordinates This manuscript PDB: 7LCI 300 kV Titan Krios K3 maps This manuscript EMDB: EMD-23274 GLP1R:PF 06882961 with Nb35 (Zhang et al., 2020) PDB: 6X1A Experimental models: cell lines Spodoptera frugiperda Expression Systems Cat# 94-001 Trichuplusia ni cells Expression Systems Cat# 94-002 CHOFlpIn Invitrogen Cat# R75807 Oligonucleotides

    Quantitation Assay:

    Article Title: Vaccination of nonhuman primates elicits a broadly neutralizing antibody lineage targeting a quaternary epitope on the HIV-1 Env trimer.
    Article Snippet: In brief HIV-1 is highly prone to mutations, and a vaccine must stimulate production of antibodies targeting conserved determinants on its exposed envelope glycoprotein (Env).. Such broadly neutralizing antibodies (bNAbs) are infrequently induced by natural infection, but their elicitation by vaccination remains challenging.. Schleich et al. describe vaccine-elicited bNAbs in NHPs recognizing a quaternary epitope, defining a promising cross-conserved Env trimer target.

    Gel Purification:

    Article Title: Vaccination of nonhuman primates elicits a broadly neutralizing antibody lineage targeting a quaternary epitope on the HIV-1 Env trimer.
    Article Snippet: In brief HIV-1 is highly prone to mutations, and a vaccine must stimulate production of antibodies targeting conserved determinants on its exposed envelope glycoprotein (Env).. Such broadly neutralizing antibodies (bNAbs) are infrequently induced by natural infection, but their elicitation by vaccination remains challenging.. Schleich et al. describe vaccine-elicited bNAbs in NHPs recognizing a quaternary epitope, defining a promising cross-conserved Env trimer target.

    Reverse Transcription:

    Article Title: Vaccination of nonhuman primates elicits a broadly neutralizing antibody lineage targeting a quaternary epitope on the HIV-1 Env trimer.
    Article Snippet: In brief HIV-1 is highly prone to mutations, and a vaccine must stimulate production of antibodies targeting conserved determinants on its exposed envelope glycoprotein (Env).. Such broadly neutralizing antibodies (bNAbs) are infrequently induced by natural infection, but their elicitation by vaccination remains challenging.. Schleich et al. describe vaccine-elicited bNAbs in NHPs recognizing a quaternary epitope, defining a promising cross-conserved Env trimer target.

    Control:

    Article Title: Vaccination of nonhuman primates elicits a broadly neutralizing antibody lineage targeting a quaternary epitope on the HIV-1 Env trimer.
    Article Snippet: In brief HIV-1 is highly prone to mutations, and a vaccine must stimulate production of antibodies targeting conserved determinants on its exposed envelope glycoprotein (Env).. Such broadly neutralizing antibodies (bNAbs) are infrequently induced by natural infection, but their elicitation by vaccination remains challenging.. Schleich et al. describe vaccine-elicited bNAbs in NHPs recognizing a quaternary epitope, defining a promising cross-conserved Env trimer target.

    Polymerase Chain Reaction:

    Article Title: Vaccination of nonhuman primates elicits a broadly neutralizing antibody lineage targeting a quaternary epitope on the HIV-1 Env trimer.
    Article Snippet: In brief HIV-1 is highly prone to mutations, and a vaccine must stimulate production of antibodies targeting conserved determinants on its exposed envelope glycoprotein (Env).. Such broadly neutralizing antibodies (bNAbs) are infrequently induced by natural infection, but their elicitation by vaccination remains challenging.. Schleich et al. describe vaccine-elicited bNAbs in NHPs recognizing a quaternary epitope, defining a promising cross-conserved Env trimer target.

    Staining:

    Article Title: Vaccination of nonhuman primates elicits a broadly neutralizing antibody lineage targeting a quaternary epitope on the HIV-1 Env trimer.
    Article Snippet: In brief HIV-1 is highly prone to mutations, and a vaccine must stimulate production of antibodies targeting conserved determinants on its exposed envelope glycoprotein (Env).. Such broadly neutralizing antibodies (bNAbs) are infrequently induced by natural infection, but their elicitation by vaccination remains challenging.. Schleich et al. describe vaccine-elicited bNAbs in NHPs recognizing a quaternary epitope, defining a promising cross-conserved Env trimer target.

    Article Title: Bacteriophage protein PEIP is a potent Bacillus subtilis enolase inhibitor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5a Competent Cells Biomed Cat#BC102-02 E. coli BL21(DE3) Competent Cells Tsingke Cat#TSV-A09 B. subtilis Competent Cells This paper Stain 168 B. subtilis bacteriophage SPO1 BENA Cluture Collection ATCC27370-B1 Chemicals, peptides and recombinant proteins 23TSINGKE Master Mix(green) Tsingke Cat#TSE101 Plasmid Mini Kit Omega Cat#D6943-01 BeyoGel SDS-PAGE Precast Gel Beyotime Cat#P0057A 103TAE buffer Aladdin Cat#T197242 Agarose Biowest Cat#YZQZT Sorbitol Aladdin Cat#S104833 Trehalose Aladdin Cat#T100010 Mannitol Aladdin Cat#M108828 K2HPO4 Aladdin Cat#16788-57-1 KH2PO4 Aladdin Cat#7778-77-0 MgCl2 Aladdin Cat#7786-30-3 Threonine Solarbio Cat#T0012 Glycine Solarbio Cat#G8200 Tween80 Aladdin Cat#T104865 NaCl Aladdin Cat#C111549 Tryptone Aladdin Cat#T139519 Yeast extract Beyotime Cat#ST968 LB medium AOBOX Cat#02-136-y250g Chloramphenicol Aladdin Cat#C100331 Kanamycin Solarbio Cat#K8020 Ampicillin sodium Aladdin Cat#A102050 Glucose Aladdin Cat#921-60-8 Isopropyl-b-D-thiogalactoside Beyotime Cat#ST098 NaH2PO4 Aladdin Cat#7558-80-7 Imidazole Aladdin Cat#I108707 EDTA-Na2 Solarbio Cat#E8030 NiSO4$6H2O Sigma Cat#227676 Precision Plus Protein Dual Color Standards Biorad Cat1610374 53Protein loading buffer Sangon Biotech Cat#C515959-0005 Coomassie brilliant blue Beyotime Cat#P0017F .. Glutaraldehyde MercK Cat#354400 Osmic acid MercK Cat#209104 Uranyl acetate American Custom Chemicals Corporation Cat#CHM0032578 Ethanol MercK Cat#E7023 Acetone MercK Cat#179124 SUMO protease Ulp1 Abbkine Cat#PRP3001 His-tagged PEIP This paper N/A (Continued on next page) Cell Reports 40, 111026, July 5, 2022 e1

    Affinity Purification:

    Article Title: Chromatin-associated cohesin turns over extensively and forms new cohesive linkages in Drosophila oocytes during meiotic prophase.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies High-affinity rat monoclonal anti-HA (clone 3F10) Roche Cat#11863423001 Lot no. 14223800; RRID: AB_390918 Mouse monoclonal anti-C3G (clone 1A8-1G2) Hawley Lab47 N/A Rabbit anti-CID Rogers Lab48 N/A GFP-Booster Alexa Fluor 488 (Alpaca anti-GFP) ChromTek Cat#gb2AF488; RRID: AB_2827573 RFP-Booster Alexa Fluor 568 (Alpaca anti-mCherry) ChromTek Cat#rb2AF568; RRID: AB_2827576 Affinity-purified guinea pig anti-Smc1 Bickel Lab26 N/A Rabbit anti-GFP Invitrogen Cat#A11122; RRID: AB_221569 Monoclonal mouse anti-alpha-tubulin (12G10) Developmental Studies Hybridoma Bank (deposited by J. Frankel and E.M. Nelson) Cat#AB_1157911; RRID:N/A Cy3 anti-rat (min-X mouse) Jackson ImmunoResearch Labs Cat#712-165-153; RRID: AB_2340667 Cy5 anti-rabbit Jackson ImmunoResearch Labs Cat#711-175-152; RRID: AB_2340607 Alexa 488 anti-mouse (min-X rat) Jackson ImmunoResearch Labs Cat#715-545-151; RRID: AB_2341099 Alkaline phosphatase goat anti-rat Sigma-Aldrich Cat#A8438; RRID: AB_258391 Alkaline phosphatase goat anti-mouse Invitrogen Cat#A16069; RRID: AB_2534742 Alkaline phosphatase goat anti-guinea pig Southern Biotech Cat#6090-04; RRID: AB_2796156 Alkaline phosphatase goat anti-rabbit Promega Cat#S373B; RRID: AB_430872 Chemicals, peptides, and recombinant proteins Formaldehyde Ted Pella Cat#18505 NP-40 Thermo Fisher Cat#28324 Tween-20 (for cytology) Thermo Fisher Cat#28320 BSA Fisher Scientific Cat#BP1605-100 DAPI Invitrogen Cat#D1306 Poly-L-lysine Sigma-Aldrich Cat#P8920 SlowFade Diamond Antifade Molecular Probes Cat#S36967 Prolong Gold Antifade Molecular Probes Cat#P36930 Vectashield Vibrance Vector Laboratories Cat#H-1700 RIPA buffer Sigma-Aldrich Cat#R0278 HALT protease inhibitor Thermo Fisher Cat#87786 Benzonase Millipore Cat#E1014 EDTA Thermo Fisher Cat#1861274 Tween-20 (for immunoblots) BioRad Cat#1610781 Centrifugal filter Millipore Cat#UFC30GV00 7.5% protein gel BioRad Cat#4568023 Precision Plus Protein Dual Color Standards BioRad Cat1610374 Immobilon-P membrane Millipore Cat#IPVH00010 AP immune star substrate BioRad Cat#1705018 Experimental models: Organisms/strains Drosophila stocks used in this study, see Table S1 This study N/A Oligonucleotides Alexa 647-labeled Oligopaint probe (OPP122), Mixture of 80-base oligos targeting 100kb distal region of the X chromosome (dm6, nucleotides 1,400,000-1,500,000) Joyce Lab, University of Pennsylvania N/A (Continued on next page) Current Biology 34, 1–12.e1–e6, July 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cy3-conjugated probe (50-Cy3-AGGGATCGTTAGCACTCGTAAT) hybridizes to 359-bp repeat in pericentric heterochromatin of the X chromosome Integrated DNA Technologies N/A Smc3* Fwd: 5’GACAAGACGCGCCGCACGCTAG AATACATTCGGTATGAGACCGAGCTGAAGGACA Integrated DNA Technologies N/A Smc3* Rev: 5’TGTCCTTCAGCTCGGTCTCATACCG AATGTATTCTAGCGTGCGGCGCGTCTTGTC Integrated DNA Technologies N/A HA stop Fwd: 5’GCTTCTAGCGAAAAAGTGTA GACGGTATCGATAAGCTTG Integrated DNA Technologies N/A HA stop Rev: 5’CAAGCTTATCGATACCGTC TACACTTTTTCGCTAGAAGC Integrated DNA Technologies N/A Smc3-WT Fwd: 5’AGCACTGGTACCGCGGCCG CAATAAGATGCACATCAAGCAG Integrated DNA Technologies N/A Smc3-WT Rev: 5’ACTGATCTCGAGGCGGCG TGGGTGCTGTCG Integrated DNA Technologies N/A Smc3-KK Fwd: 5’CGCGTGATTGGCGCCAGAA GGGACCAGTACTTCC Integrated DNA Technologies N/A Smc3-KK Rev: 5’GGAAGTACTGGTCCCTTCTGG CGCCAATCACGCG Integrated DNA Technologies N/A Recombinant DNA Clone RE14758 (Smc3 cDNA) DGRC Stock 8520; RRID:DGRC_8502 pUASP-attB Gift from Hawley lab49 RRID: N/A w+ attB vector Addgene (donated by Jeff Sekelsky) Plasmid# 30326; RRID: Addgene_30326 Software and algorithms Volocity Visualization, Restoration, and Quantitation Quorum Technologies, Canada Version 6.5.0 https://www.volocity4d.com/ downloadhttps://www. volocity4d.com/download Volocity Acquisition (for epifluorescence imaging) Quorum Technologies, Canada Version 6.5.1 https://www.volocity4d.com/ volocity-acquisition Nikon Elements (for spinning disc confocal imaging) Nikon Version 5.11.02 Build 1369 MATLAB Mathworks Version R2022a https://www.mathworks.com/ products/new_products/ release2022a.html BioRad Image Lab BioRad Version 6.1 https://www.bio-rad.com/ en-us/product/image-labsoftware?ID=KRE6P5E8Z Microsoft Office Microsoft Version 16.84 Affinity Designer Affinity Version 1.10.6.1665 https://affinity.serif.com/ en-us/designer/ Other Chemi Doc Touch Imaging system BioRad Serial no. 732BR0120 e2 Current Biology 34, 1–12.e1–e6, July 8, 2024 Article

    Recombinant:

    Article Title: Chromatin-associated cohesin turns over extensively and forms new cohesive linkages in Drosophila oocytes during meiotic prophase.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies High-affinity rat monoclonal anti-HA (clone 3F10) Roche Cat#11863423001 Lot no. 14223800; RRID: AB_390918 Mouse monoclonal anti-C3G (clone 1A8-1G2) Hawley Lab47 N/A Rabbit anti-CID Rogers Lab48 N/A GFP-Booster Alexa Fluor 488 (Alpaca anti-GFP) ChromTek Cat#gb2AF488; RRID: AB_2827573 RFP-Booster Alexa Fluor 568 (Alpaca anti-mCherry) ChromTek Cat#rb2AF568; RRID: AB_2827576 Affinity-purified guinea pig anti-Smc1 Bickel Lab26 N/A Rabbit anti-GFP Invitrogen Cat#A11122; RRID: AB_221569 Monoclonal mouse anti-alpha-tubulin (12G10) Developmental Studies Hybridoma Bank (deposited by J. Frankel and E.M. Nelson) Cat#AB_1157911; RRID:N/A Cy3 anti-rat (min-X mouse) Jackson ImmunoResearch Labs Cat#712-165-153; RRID: AB_2340667 Cy5 anti-rabbit Jackson ImmunoResearch Labs Cat#711-175-152; RRID: AB_2340607 Alexa 488 anti-mouse (min-X rat) Jackson ImmunoResearch Labs Cat#715-545-151; RRID: AB_2341099 Alkaline phosphatase goat anti-rat Sigma-Aldrich Cat#A8438; RRID: AB_258391 Alkaline phosphatase goat anti-mouse Invitrogen Cat#A16069; RRID: AB_2534742 Alkaline phosphatase goat anti-guinea pig Southern Biotech Cat#6090-04; RRID: AB_2796156 Alkaline phosphatase goat anti-rabbit Promega Cat#S373B; RRID: AB_430872 Chemicals, peptides, and recombinant proteins Formaldehyde Ted Pella Cat#18505 NP-40 Thermo Fisher Cat#28324 Tween-20 (for cytology) Thermo Fisher Cat#28320 BSA Fisher Scientific Cat#BP1605-100 DAPI Invitrogen Cat#D1306 Poly-L-lysine Sigma-Aldrich Cat#P8920 SlowFade Diamond Antifade Molecular Probes Cat#S36967 Prolong Gold Antifade Molecular Probes Cat#P36930 Vectashield Vibrance Vector Laboratories Cat#H-1700 RIPA buffer Sigma-Aldrich Cat#R0278 HALT protease inhibitor Thermo Fisher Cat#87786 Benzonase Millipore Cat#E1014 EDTA Thermo Fisher Cat#1861274 Tween-20 (for immunoblots) BioRad Cat#1610781 Centrifugal filter Millipore Cat#UFC30GV00 7.5% protein gel BioRad Cat#4568023 Precision Plus Protein Dual Color Standards BioRad Cat1610374 Immobilon-P membrane Millipore Cat#IPVH00010 AP immune star substrate BioRad Cat#1705018 Experimental models: Organisms/strains Drosophila stocks used in this study, see Table S1 This study N/A Oligonucleotides Alexa 647-labeled Oligopaint probe (OPP122), Mixture of 80-base oligos targeting 100kb distal region of the X chromosome (dm6, nucleotides 1,400,000-1,500,000) Joyce Lab, University of Pennsylvania N/A (Continued on next page) Current Biology 34, 1–12.e1–e6, July 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cy3-conjugated probe (50-Cy3-AGGGATCGTTAGCACTCGTAAT) hybridizes to 359-bp repeat in pericentric heterochromatin of the X chromosome Integrated DNA Technologies N/A Smc3* Fwd: 5’GACAAGACGCGCCGCACGCTAG AATACATTCGGTATGAGACCGAGCTGAAGGACA Integrated DNA Technologies N/A Smc3* Rev: 5’TGTCCTTCAGCTCGGTCTCATACCG AATGTATTCTAGCGTGCGGCGCGTCTTGTC Integrated DNA Technologies N/A HA stop Fwd: 5’GCTTCTAGCGAAAAAGTGTA GACGGTATCGATAAGCTTG Integrated DNA Technologies N/A HA stop Rev: 5’CAAGCTTATCGATACCGTC TACACTTTTTCGCTAGAAGC Integrated DNA Technologies N/A Smc3-WT Fwd: 5’AGCACTGGTACCGCGGCCG CAATAAGATGCACATCAAGCAG Integrated DNA Technologies N/A Smc3-WT Rev: 5’ACTGATCTCGAGGCGGCG TGGGTGCTGTCG Integrated DNA Technologies N/A Smc3-KK Fwd: 5’CGCGTGATTGGCGCCAGAA GGGACCAGTACTTCC Integrated DNA Technologies N/A Smc3-KK Rev: 5’GGAAGTACTGGTCCCTTCTGG CGCCAATCACGCG Integrated DNA Technologies N/A Recombinant DNA Clone RE14758 (Smc3 cDNA) DGRC Stock 8520; RRID:DGRC_8502 pUASP-attB Gift from Hawley lab49 RRID: N/A w+ attB vector Addgene (donated by Jeff Sekelsky) Plasmid# 30326; RRID: Addgene_30326 Software and algorithms Volocity Visualization, Restoration, and Quantitation Quorum Technologies, Canada Version 6.5.0 https://www.volocity4d.com/ downloadhttps://www. volocity4d.com/download Volocity Acquisition (for epifluorescence imaging) Quorum Technologies, Canada Version 6.5.1 https://www.volocity4d.com/ volocity-acquisition Nikon Elements (for spinning disc confocal imaging) Nikon Version 5.11.02 Build 1369 MATLAB Mathworks Version R2022a https://www.mathworks.com/ products/new_products/ release2022a.html BioRad Image Lab BioRad Version 6.1 https://www.bio-rad.com/ en-us/product/image-labsoftware?ID=KRE6P5E8Z Microsoft Office Microsoft Version 16.84 Affinity Designer Affinity Version 1.10.6.1665 https://affinity.serif.com/ en-us/designer/ Other Chemi Doc Touch Imaging system BioRad Serial no. 732BR0120 e2 Current Biology 34, 1–12.e1–e6, July 8, 2024 Article

    Article Title: Bacteriophage protein PEIP is a potent Bacillus subtilis enolase inhibitor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5a Competent Cells Biomed Cat#BC102-02 E. coli BL21(DE3) Competent Cells Tsingke Cat#TSV-A09 B. subtilis Competent Cells This paper Stain 168 B. subtilis bacteriophage SPO1 BENA Cluture Collection ATCC27370-B1 Chemicals, peptides and recombinant proteins 23TSINGKE Master Mix(green) Tsingke Cat#TSE101 Plasmid Mini Kit Omega Cat#D6943-01 BeyoGel SDS-PAGE Precast Gel Beyotime Cat#P0057A 103TAE buffer Aladdin Cat#T197242 Agarose Biowest Cat#YZQZT Sorbitol Aladdin Cat#S104833 Trehalose Aladdin Cat#T100010 Mannitol Aladdin Cat#M108828 K2HPO4 Aladdin Cat#16788-57-1 KH2PO4 Aladdin Cat#7778-77-0 MgCl2 Aladdin Cat#7786-30-3 Threonine Solarbio Cat#T0012 Glycine Solarbio Cat#G8200 Tween80 Aladdin Cat#T104865 NaCl Aladdin Cat#C111549 Tryptone Aladdin Cat#T139519 Yeast extract Beyotime Cat#ST968 LB medium AOBOX Cat#02-136-y250g Chloramphenicol Aladdin Cat#C100331 Kanamycin Solarbio Cat#K8020 Ampicillin sodium Aladdin Cat#A102050 Glucose Aladdin Cat#921-60-8 Isopropyl-b-D-thiogalactoside Beyotime Cat#ST098 NaH2PO4 Aladdin Cat#7558-80-7 Imidazole Aladdin Cat#I108707 EDTA-Na2 Solarbio Cat#E8030 NiSO4$6H2O Sigma Cat#227676 Precision Plus Protein Dual Color Standards Biorad Cat1610374 53Protein loading buffer Sangon Biotech Cat#C515959-0005 Coomassie brilliant blue Beyotime Cat#P0017F .. Glutaraldehyde MercK Cat#354400 Osmic acid MercK Cat#209104 Uranyl acetate American Custom Chemicals Corporation Cat#CHM0032578 Ethanol MercK Cat#E7023 Acetone MercK Cat#179124 SUMO protease Ulp1 Abbkine Cat#PRP3001 His-tagged PEIP This paper N/A (Continued on next page) Cell Reports 40, 111026, July 5, 2022 e1

    Article Title: Evolving cryo-EM structural approaches for GPCR drug discovery.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Gs C-18 antibody Santa Cruz Cat# sc-383; RRID: AB_631539 mouse poly-His antibody QIAGEN Cat# 34660; RRID: AB_2619735 gp64-PE antibody Thermo Fisher Cat# 12-6991-82; RRID: AB_1633369 IRDye 680RD Goat anti-Mouse IgG LI-COR Cat# LCR-926-68070: RRID: AB_10956588 IRDye 800CW Goat anti-Rabbit IgG LI-COR Cat# LCR-925-32211: RRID: AB_2651127 Bacterial and virus strains Escherichia Coli BL21 ThermoFisher Cat# C600003 Chemicals, peptides, and recombinant proteins PF-06882961 Servier, France N/A ESF 921 serum-free media Expression Systems Cat# 96-001 Opti-MEM I Reduced Serum Medium Thermo Fisher Scientific Cat# 31985088 cOmplete Protease Inhibitor Cocktail tablets Roche Cat# 5056489001 Apyrase NEB Cat# M0398S Lauryl maltose neopentyl glycol Anatrace Cat# NG310 Cholesteryl hemisuccinate Anatrace Cat# CH210 Benzonase Merk Millipore Cat# 71205-3 Flag peptide Sigma-Aldrich Cat# F3290 M1 anti-Flag affinity resin Sigma-Aldrich Cat# A4596 Superdex 200 Increase 10/300 column GE Healthcare Cat# 28990944 Ni-NTA agarose Qiagen Cat# 30230 Anti-Flag M1 ATCC Hybridoma ATCC HB- 259;RRID:CVCL_J730 Amicon Ultra Centrifugal Filter (MWCO, 100 kDa) Merk Millipore UFC910024 TGX Precast Gel BioRad Cat#4561086 Precision Plus Protein Dual Color Standards BioRad Cat# 1610394 Instant Blue Sigma-Aldrich Cat# ISB1L PVDF membrane BioRad Cat# 1620264 FuGENE HD Transfection Reagent Promega Cat# E2311 Critical commercial assays Lance cAMP detection kit PerkinElmer Cat# AD0264 QuikChange site-directed mutagenesis kit Agilent Cat# 200521 Bac to Bac system ThermoFisher Cat# A11098 NanoBRET Nano-Glo substrate Promega Cat#N1572 Coelenterazine H NanoLight Cat#301 Fluo-8 AM Green Fluorescent Calcium binding dye Abcam Cat#142773 Deposited data 200 kV Glacios coordinates This manuscript PDB: 7LCK 200 kV Glacios maps This manuscript EMDB: EMD-23276 300 kV Titan Krios Falcon 4 coordinates This manuscript PDB: 7LCJ 300 kV Titan Krios Falcon 4 maps This manuscript EMDB: EMD-23275 (Continued on next page) Structure 29, 963–974.e1–e6, September 2, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER 300 kV Titan Krios K3 coordinates This manuscript PDB: 7LCI 300 kV Titan Krios K3 maps This manuscript EMDB: EMD-23274 GLP1R:PF 06882961 with Nb35 (Zhang et al., 2020) PDB: 6X1A Experimental models: cell lines Spodoptera frugiperda Expression Systems Cat# 94-001 Trichuplusia ni cells Expression Systems Cat# 94-002 CHOFlpIn Invitrogen Cat# R75807 Oligonucleotides

    Protease Inhibitor:

    Article Title: Chromatin-associated cohesin turns over extensively and forms new cohesive linkages in Drosophila oocytes during meiotic prophase.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies High-affinity rat monoclonal anti-HA (clone 3F10) Roche Cat#11863423001 Lot no. 14223800; RRID: AB_390918 Mouse monoclonal anti-C3G (clone 1A8-1G2) Hawley Lab47 N/A Rabbit anti-CID Rogers Lab48 N/A GFP-Booster Alexa Fluor 488 (Alpaca anti-GFP) ChromTek Cat#gb2AF488; RRID: AB_2827573 RFP-Booster Alexa Fluor 568 (Alpaca anti-mCherry) ChromTek Cat#rb2AF568; RRID: AB_2827576 Affinity-purified guinea pig anti-Smc1 Bickel Lab26 N/A Rabbit anti-GFP Invitrogen Cat#A11122; RRID: AB_221569 Monoclonal mouse anti-alpha-tubulin (12G10) Developmental Studies Hybridoma Bank (deposited by J. Frankel and E.M. Nelson) Cat#AB_1157911; RRID:N/A Cy3 anti-rat (min-X mouse) Jackson ImmunoResearch Labs Cat#712-165-153; RRID: AB_2340667 Cy5 anti-rabbit Jackson ImmunoResearch Labs Cat#711-175-152; RRID: AB_2340607 Alexa 488 anti-mouse (min-X rat) Jackson ImmunoResearch Labs Cat#715-545-151; RRID: AB_2341099 Alkaline phosphatase goat anti-rat Sigma-Aldrich Cat#A8438; RRID: AB_258391 Alkaline phosphatase goat anti-mouse Invitrogen Cat#A16069; RRID: AB_2534742 Alkaline phosphatase goat anti-guinea pig Southern Biotech Cat#6090-04; RRID: AB_2796156 Alkaline phosphatase goat anti-rabbit Promega Cat#S373B; RRID: AB_430872 Chemicals, peptides, and recombinant proteins Formaldehyde Ted Pella Cat#18505 NP-40 Thermo Fisher Cat#28324 Tween-20 (for cytology) Thermo Fisher Cat#28320 BSA Fisher Scientific Cat#BP1605-100 DAPI Invitrogen Cat#D1306 Poly-L-lysine Sigma-Aldrich Cat#P8920 SlowFade Diamond Antifade Molecular Probes Cat#S36967 Prolong Gold Antifade Molecular Probes Cat#P36930 Vectashield Vibrance Vector Laboratories Cat#H-1700 RIPA buffer Sigma-Aldrich Cat#R0278 HALT protease inhibitor Thermo Fisher Cat#87786 Benzonase Millipore Cat#E1014 EDTA Thermo Fisher Cat#1861274 Tween-20 (for immunoblots) BioRad Cat#1610781 Centrifugal filter Millipore Cat#UFC30GV00 7.5% protein gel BioRad Cat#4568023 Precision Plus Protein Dual Color Standards BioRad Cat1610374 Immobilon-P membrane Millipore Cat#IPVH00010 AP immune star substrate BioRad Cat#1705018 Experimental models: Organisms/strains Drosophila stocks used in this study, see Table S1 This study N/A Oligonucleotides Alexa 647-labeled Oligopaint probe (OPP122), Mixture of 80-base oligos targeting 100kb distal region of the X chromosome (dm6, nucleotides 1,400,000-1,500,000) Joyce Lab, University of Pennsylvania N/A (Continued on next page) Current Biology 34, 1–12.e1–e6, July 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cy3-conjugated probe (50-Cy3-AGGGATCGTTAGCACTCGTAAT) hybridizes to 359-bp repeat in pericentric heterochromatin of the X chromosome Integrated DNA Technologies N/A Smc3* Fwd: 5’GACAAGACGCGCCGCACGCTAG AATACATTCGGTATGAGACCGAGCTGAAGGACA Integrated DNA Technologies N/A Smc3* Rev: 5’TGTCCTTCAGCTCGGTCTCATACCG AATGTATTCTAGCGTGCGGCGCGTCTTGTC Integrated DNA Technologies N/A HA stop Fwd: 5’GCTTCTAGCGAAAAAGTGTA GACGGTATCGATAAGCTTG Integrated DNA Technologies N/A HA stop Rev: 5’CAAGCTTATCGATACCGTC TACACTTTTTCGCTAGAAGC Integrated DNA Technologies N/A Smc3-WT Fwd: 5’AGCACTGGTACCGCGGCCG CAATAAGATGCACATCAAGCAG Integrated DNA Technologies N/A Smc3-WT Rev: 5’ACTGATCTCGAGGCGGCG TGGGTGCTGTCG Integrated DNA Technologies N/A Smc3-KK Fwd: 5’CGCGTGATTGGCGCCAGAA GGGACCAGTACTTCC Integrated DNA Technologies N/A Smc3-KK Rev: 5’GGAAGTACTGGTCCCTTCTGG CGCCAATCACGCG Integrated DNA Technologies N/A Recombinant DNA Clone RE14758 (Smc3 cDNA) DGRC Stock 8520; RRID:DGRC_8502 pUASP-attB Gift from Hawley lab49 RRID: N/A w+ attB vector Addgene (donated by Jeff Sekelsky) Plasmid# 30326; RRID: Addgene_30326 Software and algorithms Volocity Visualization, Restoration, and Quantitation Quorum Technologies, Canada Version 6.5.0 https://www.volocity4d.com/ downloadhttps://www. volocity4d.com/download Volocity Acquisition (for epifluorescence imaging) Quorum Technologies, Canada Version 6.5.1 https://www.volocity4d.com/ volocity-acquisition Nikon Elements (for spinning disc confocal imaging) Nikon Version 5.11.02 Build 1369 MATLAB Mathworks Version R2022a https://www.mathworks.com/ products/new_products/ release2022a.html BioRad Image Lab BioRad Version 6.1 https://www.bio-rad.com/ en-us/product/image-labsoftware?ID=KRE6P5E8Z Microsoft Office Microsoft Version 16.84 Affinity Designer Affinity Version 1.10.6.1665 https://affinity.serif.com/ en-us/designer/ Other Chemi Doc Touch Imaging system BioRad Serial no. 732BR0120 e2 Current Biology 34, 1–12.e1–e6, July 8, 2024 Article

    Article Title: Evolving cryo-EM structural approaches for GPCR drug discovery.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Gs C-18 antibody Santa Cruz Cat# sc-383; RRID: AB_631539 mouse poly-His antibody QIAGEN Cat# 34660; RRID: AB_2619735 gp64-PE antibody Thermo Fisher Cat# 12-6991-82; RRID: AB_1633369 IRDye 680RD Goat anti-Mouse IgG LI-COR Cat# LCR-926-68070: RRID: AB_10956588 IRDye 800CW Goat anti-Rabbit IgG LI-COR Cat# LCR-925-32211: RRID: AB_2651127 Bacterial and virus strains Escherichia Coli BL21 ThermoFisher Cat# C600003 Chemicals, peptides, and recombinant proteins PF-06882961 Servier, France N/A ESF 921 serum-free media Expression Systems Cat# 96-001 Opti-MEM I Reduced Serum Medium Thermo Fisher Scientific Cat# 31985088 cOmplete Protease Inhibitor Cocktail tablets Roche Cat# 5056489001 Apyrase NEB Cat# M0398S Lauryl maltose neopentyl glycol Anatrace Cat# NG310 Cholesteryl hemisuccinate Anatrace Cat# CH210 Benzonase Merk Millipore Cat# 71205-3 Flag peptide Sigma-Aldrich Cat# F3290 M1 anti-Flag affinity resin Sigma-Aldrich Cat# A4596 Superdex 200 Increase 10/300 column GE Healthcare Cat# 28990944 Ni-NTA agarose Qiagen Cat# 30230 Anti-Flag M1 ATCC Hybridoma ATCC HB- 259;RRID:CVCL_J730 Amicon Ultra Centrifugal Filter (MWCO, 100 kDa) Merk Millipore UFC910024 TGX Precast Gel BioRad Cat#4561086 Precision Plus Protein Dual Color Standards BioRad Cat# 1610394 Instant Blue Sigma-Aldrich Cat# ISB1L PVDF membrane BioRad Cat# 1620264 FuGENE HD Transfection Reagent Promega Cat# E2311 Critical commercial assays Lance cAMP detection kit PerkinElmer Cat# AD0264 QuikChange site-directed mutagenesis kit Agilent Cat# 200521 Bac to Bac system ThermoFisher Cat# A11098 NanoBRET Nano-Glo substrate Promega Cat#N1572 Coelenterazine H NanoLight Cat#301 Fluo-8 AM Green Fluorescent Calcium binding dye Abcam Cat#142773 Deposited data 200 kV Glacios coordinates This manuscript PDB: 7LCK 200 kV Glacios maps This manuscript EMDB: EMD-23276 300 kV Titan Krios Falcon 4 coordinates This manuscript PDB: 7LCJ 300 kV Titan Krios Falcon 4 maps This manuscript EMDB: EMD-23275 (Continued on next page) Structure 29, 963–974.e1–e6, September 2, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER 300 kV Titan Krios K3 coordinates This manuscript PDB: 7LCI 300 kV Titan Krios K3 maps This manuscript EMDB: EMD-23274 GLP1R:PF 06882961 with Nb35 (Zhang et al., 2020) PDB: 6X1A Experimental models: cell lines Spodoptera frugiperda Expression Systems Cat# 94-001 Trichuplusia ni cells Expression Systems Cat# 94-002 CHOFlpIn Invitrogen Cat# R75807 Oligonucleotides

    Western Blot:

    Article Title: Chromatin-associated cohesin turns over extensively and forms new cohesive linkages in Drosophila oocytes during meiotic prophase.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies High-affinity rat monoclonal anti-HA (clone 3F10) Roche Cat#11863423001 Lot no. 14223800; RRID: AB_390918 Mouse monoclonal anti-C3G (clone 1A8-1G2) Hawley Lab47 N/A Rabbit anti-CID Rogers Lab48 N/A GFP-Booster Alexa Fluor 488 (Alpaca anti-GFP) ChromTek Cat#gb2AF488; RRID: AB_2827573 RFP-Booster Alexa Fluor 568 (Alpaca anti-mCherry) ChromTek Cat#rb2AF568; RRID: AB_2827576 Affinity-purified guinea pig anti-Smc1 Bickel Lab26 N/A Rabbit anti-GFP Invitrogen Cat#A11122; RRID: AB_221569 Monoclonal mouse anti-alpha-tubulin (12G10) Developmental Studies Hybridoma Bank (deposited by J. Frankel and E.M. Nelson) Cat#AB_1157911; RRID:N/A Cy3 anti-rat (min-X mouse) Jackson ImmunoResearch Labs Cat#712-165-153; RRID: AB_2340667 Cy5 anti-rabbit Jackson ImmunoResearch Labs Cat#711-175-152; RRID: AB_2340607 Alexa 488 anti-mouse (min-X rat) Jackson ImmunoResearch Labs Cat#715-545-151; RRID: AB_2341099 Alkaline phosphatase goat anti-rat Sigma-Aldrich Cat#A8438; RRID: AB_258391 Alkaline phosphatase goat anti-mouse Invitrogen Cat#A16069; RRID: AB_2534742 Alkaline phosphatase goat anti-guinea pig Southern Biotech Cat#6090-04; RRID: AB_2796156 Alkaline phosphatase goat anti-rabbit Promega Cat#S373B; RRID: AB_430872 Chemicals, peptides, and recombinant proteins Formaldehyde Ted Pella Cat#18505 NP-40 Thermo Fisher Cat#28324 Tween-20 (for cytology) Thermo Fisher Cat#28320 BSA Fisher Scientific Cat#BP1605-100 DAPI Invitrogen Cat#D1306 Poly-L-lysine Sigma-Aldrich Cat#P8920 SlowFade Diamond Antifade Molecular Probes Cat#S36967 Prolong Gold Antifade Molecular Probes Cat#P36930 Vectashield Vibrance Vector Laboratories Cat#H-1700 RIPA buffer Sigma-Aldrich Cat#R0278 HALT protease inhibitor Thermo Fisher Cat#87786 Benzonase Millipore Cat#E1014 EDTA Thermo Fisher Cat#1861274 Tween-20 (for immunoblots) BioRad Cat#1610781 Centrifugal filter Millipore Cat#UFC30GV00 7.5% protein gel BioRad Cat#4568023 Precision Plus Protein Dual Color Standards BioRad Cat1610374 Immobilon-P membrane Millipore Cat#IPVH00010 AP immune star substrate BioRad Cat#1705018 Experimental models: Organisms/strains Drosophila stocks used in this study, see Table S1 This study N/A Oligonucleotides Alexa 647-labeled Oligopaint probe (OPP122), Mixture of 80-base oligos targeting 100kb distal region of the X chromosome (dm6, nucleotides 1,400,000-1,500,000) Joyce Lab, University of Pennsylvania N/A (Continued on next page) Current Biology 34, 1–12.e1–e6, July 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cy3-conjugated probe (50-Cy3-AGGGATCGTTAGCACTCGTAAT) hybridizes to 359-bp repeat in pericentric heterochromatin of the X chromosome Integrated DNA Technologies N/A Smc3* Fwd: 5’GACAAGACGCGCCGCACGCTAG AATACATTCGGTATGAGACCGAGCTGAAGGACA Integrated DNA Technologies N/A Smc3* Rev: 5’TGTCCTTCAGCTCGGTCTCATACCG AATGTATTCTAGCGTGCGGCGCGTCTTGTC Integrated DNA Technologies N/A HA stop Fwd: 5’GCTTCTAGCGAAAAAGTGTA GACGGTATCGATAAGCTTG Integrated DNA Technologies N/A HA stop Rev: 5’CAAGCTTATCGATACCGTC TACACTTTTTCGCTAGAAGC Integrated DNA Technologies N/A Smc3-WT Fwd: 5’AGCACTGGTACCGCGGCCG CAATAAGATGCACATCAAGCAG Integrated DNA Technologies N/A Smc3-WT Rev: 5’ACTGATCTCGAGGCGGCG TGGGTGCTGTCG Integrated DNA Technologies N/A Smc3-KK Fwd: 5’CGCGTGATTGGCGCCAGAA GGGACCAGTACTTCC Integrated DNA Technologies N/A Smc3-KK Rev: 5’GGAAGTACTGGTCCCTTCTGG CGCCAATCACGCG Integrated DNA Technologies N/A Recombinant DNA Clone RE14758 (Smc3 cDNA) DGRC Stock 8520; RRID:DGRC_8502 pUASP-attB Gift from Hawley lab49 RRID: N/A w+ attB vector Addgene (donated by Jeff Sekelsky) Plasmid# 30326; RRID: Addgene_30326 Software and algorithms Volocity Visualization, Restoration, and Quantitation Quorum Technologies, Canada Version 6.5.0 https://www.volocity4d.com/ downloadhttps://www. volocity4d.com/download Volocity Acquisition (for epifluorescence imaging) Quorum Technologies, Canada Version 6.5.1 https://www.volocity4d.com/ volocity-acquisition Nikon Elements (for spinning disc confocal imaging) Nikon Version 5.11.02 Build 1369 MATLAB Mathworks Version R2022a https://www.mathworks.com/ products/new_products/ release2022a.html BioRad Image Lab BioRad Version 6.1 https://www.bio-rad.com/ en-us/product/image-labsoftware?ID=KRE6P5E8Z Microsoft Office Microsoft Version 16.84 Affinity Designer Affinity Version 1.10.6.1665 https://affinity.serif.com/ en-us/designer/ Other Chemi Doc Touch Imaging system BioRad Serial no. 732BR0120 e2 Current Biology 34, 1–12.e1–e6, July 8, 2024 Article

    Membrane:

    Article Title: Chromatin-associated cohesin turns over extensively and forms new cohesive linkages in Drosophila oocytes during meiotic prophase.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies High-affinity rat monoclonal anti-HA (clone 3F10) Roche Cat#11863423001 Lot no. 14223800; RRID: AB_390918 Mouse monoclonal anti-C3G (clone 1A8-1G2) Hawley Lab47 N/A Rabbit anti-CID Rogers Lab48 N/A GFP-Booster Alexa Fluor 488 (Alpaca anti-GFP) ChromTek Cat#gb2AF488; RRID: AB_2827573 RFP-Booster Alexa Fluor 568 (Alpaca anti-mCherry) ChromTek Cat#rb2AF568; RRID: AB_2827576 Affinity-purified guinea pig anti-Smc1 Bickel Lab26 N/A Rabbit anti-GFP Invitrogen Cat#A11122; RRID: AB_221569 Monoclonal mouse anti-alpha-tubulin (12G10) Developmental Studies Hybridoma Bank (deposited by J. Frankel and E.M. Nelson) Cat#AB_1157911; RRID:N/A Cy3 anti-rat (min-X mouse) Jackson ImmunoResearch Labs Cat#712-165-153; RRID: AB_2340667 Cy5 anti-rabbit Jackson ImmunoResearch Labs Cat#711-175-152; RRID: AB_2340607 Alexa 488 anti-mouse (min-X rat) Jackson ImmunoResearch Labs Cat#715-545-151; RRID: AB_2341099 Alkaline phosphatase goat anti-rat Sigma-Aldrich Cat#A8438; RRID: AB_258391 Alkaline phosphatase goat anti-mouse Invitrogen Cat#A16069; RRID: AB_2534742 Alkaline phosphatase goat anti-guinea pig Southern Biotech Cat#6090-04; RRID: AB_2796156 Alkaline phosphatase goat anti-rabbit Promega Cat#S373B; RRID: AB_430872 Chemicals, peptides, and recombinant proteins Formaldehyde Ted Pella Cat#18505 NP-40 Thermo Fisher Cat#28324 Tween-20 (for cytology) Thermo Fisher Cat#28320 BSA Fisher Scientific Cat#BP1605-100 DAPI Invitrogen Cat#D1306 Poly-L-lysine Sigma-Aldrich Cat#P8920 SlowFade Diamond Antifade Molecular Probes Cat#S36967 Prolong Gold Antifade Molecular Probes Cat#P36930 Vectashield Vibrance Vector Laboratories Cat#H-1700 RIPA buffer Sigma-Aldrich Cat#R0278 HALT protease inhibitor Thermo Fisher Cat#87786 Benzonase Millipore Cat#E1014 EDTA Thermo Fisher Cat#1861274 Tween-20 (for immunoblots) BioRad Cat#1610781 Centrifugal filter Millipore Cat#UFC30GV00 7.5% protein gel BioRad Cat#4568023 Precision Plus Protein Dual Color Standards BioRad Cat1610374 Immobilon-P membrane Millipore Cat#IPVH00010 AP immune star substrate BioRad Cat#1705018 Experimental models: Organisms/strains Drosophila stocks used in this study, see Table S1 This study N/A Oligonucleotides Alexa 647-labeled Oligopaint probe (OPP122), Mixture of 80-base oligos targeting 100kb distal region of the X chromosome (dm6, nucleotides 1,400,000-1,500,000) Joyce Lab, University of Pennsylvania N/A (Continued on next page) Current Biology 34, 1–12.e1–e6, July 8, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Cy3-conjugated probe (50-Cy3-AGGGATCGTTAGCACTCGTAAT) hybridizes to 359-bp repeat in pericentric heterochromatin of the X chromosome Integrated DNA Technologies N/A Smc3* Fwd: 5’GACAAGACGCGCCGCACGCTAG AATACATTCGGTATGAGACCGAGCTGAAGGACA Integrated DNA Technologies N/A Smc3* Rev: 5’TGTCCTTCAGCTCGGTCTCATACCG AATGTATTCTAGCGTGCGGCGCGTCTTGTC Integrated DNA Technologies N/A HA stop Fwd: 5’GCTTCTAGCGAAAAAGTGTA GACGGTATCGATAAGCTTG Integrated DNA Technologies N/A HA stop Rev: 5’CAAGCTTATCGATACCGTC TACACTTTTTCGCTAGAAGC Integrated DNA Technologies N/A Smc3-WT Fwd: 5’AGCACTGGTACCGCGGCCG CAATAAGATGCACATCAAGCAG Integrated DNA Technologies N/A Smc3-WT Rev: 5’ACTGATCTCGAGGCGGCG TGGGTGCTGTCG Integrated DNA Technologies N/A Smc3-KK Fwd: 5’CGCGTGATTGGCGCCAGAA GGGACCAGTACTTCC Integrated DNA Technologies N/A Smc3-KK Rev: 5’GGAAGTACTGGTCCCTTCTGG CGCCAATCACGCG Integrated DNA Technologies N/A Recombinant DNA Clone RE14758 (Smc3 cDNA) DGRC Stock 8520; RRID:DGRC_8502 pUASP-attB Gift from Hawley lab49 RRID: N/A w+ attB vector Addgene (donated by Jeff Sekelsky) Plasmid# 30326; RRID: Addgene_30326 Software and algorithms Volocity Visualization, Restoration, and Quantitation Quorum Technologies, Canada Version 6.5.0 https://www.volocity4d.com/ downloadhttps://www. volocity4d.com/download Volocity Acquisition (for epifluorescence imaging) Quorum Technologies, Canada Version 6.5.1 https://www.volocity4d.com/ volocity-acquisition Nikon Elements (for spinning disc confocal imaging) Nikon Version 5.11.02 Build 1369 MATLAB Mathworks Version R2022a https://www.mathworks.com/ products/new_products/ release2022a.html BioRad Image Lab BioRad Version 6.1 https://www.bio-rad.com/ en-us/product/image-labsoftware?ID=KRE6P5E8Z Microsoft Office Microsoft Version 16.84 Affinity Designer Affinity Version 1.10.6.1665 https://affinity.serif.com/ en-us/designer/ Other Chemi Doc Touch Imaging system BioRad Serial no. 732BR0120 e2 Current Biology 34, 1–12.e1–e6, July 8, 2024 Article

    Article Title: Evolving cryo-EM structural approaches for GPCR drug discovery.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Gs C-18 antibody Santa Cruz Cat# sc-383; RRID: AB_631539 mouse poly-His antibody QIAGEN Cat# 34660; RRID: AB_2619735 gp64-PE antibody Thermo Fisher Cat# 12-6991-82; RRID: AB_1633369 IRDye 680RD Goat anti-Mouse IgG LI-COR Cat# LCR-926-68070: RRID: AB_10956588 IRDye 800CW Goat anti-Rabbit IgG LI-COR Cat# LCR-925-32211: RRID: AB_2651127 Bacterial and virus strains Escherichia Coli BL21 ThermoFisher Cat# C600003 Chemicals, peptides, and recombinant proteins PF-06882961 Servier, France N/A ESF 921 serum-free media Expression Systems Cat# 96-001 Opti-MEM I Reduced Serum Medium Thermo Fisher Scientific Cat# 31985088 cOmplete Protease Inhibitor Cocktail tablets Roche Cat# 5056489001 Apyrase NEB Cat# M0398S Lauryl maltose neopentyl glycol Anatrace Cat# NG310 Cholesteryl hemisuccinate Anatrace Cat# CH210 Benzonase Merk Millipore Cat# 71205-3 Flag peptide Sigma-Aldrich Cat# F3290 M1 anti-Flag affinity resin Sigma-Aldrich Cat# A4596 Superdex 200 Increase 10/300 column GE Healthcare Cat# 28990944 Ni-NTA agarose Qiagen Cat# 30230 Anti-Flag M1 ATCC Hybridoma ATCC HB- 259;RRID:CVCL_J730 Amicon Ultra Centrifugal Filter (MWCO, 100 kDa) Merk Millipore UFC910024 TGX Precast Gel BioRad Cat#4561086 Precision Plus Protein Dual Color Standards BioRad Cat# 1610394 Instant Blue Sigma-Aldrich Cat# ISB1L PVDF membrane BioRad Cat# 1620264 FuGENE HD Transfection Reagent Promega Cat# E2311 Critical commercial assays Lance cAMP detection kit PerkinElmer Cat# AD0264 QuikChange site-directed mutagenesis kit Agilent Cat# 200521 Bac to Bac system ThermoFisher Cat# A11098 NanoBRET Nano-Glo substrate Promega Cat#N1572 Coelenterazine H NanoLight Cat#301 Fluo-8 AM Green Fluorescent Calcium binding dye Abcam Cat#142773 Deposited data 200 kV Glacios coordinates This manuscript PDB: 7LCK 200 kV Glacios maps This manuscript EMDB: EMD-23276 300 kV Titan Krios Falcon 4 coordinates This manuscript PDB: 7LCJ 300 kV Titan Krios Falcon 4 maps This manuscript EMDB: EMD-23275 (Continued on next page) Structure 29, 963–974.e1–e6, September 2, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER 300 kV Titan Krios K3 coordinates This manuscript PDB: 7LCI 300 kV Titan Krios K3 maps This manuscript EMDB: EMD-23274 GLP1R:PF 06882961 with Nb35 (Zhang et al., 2020) PDB: 6X1A Experimental models: cell lines Spodoptera frugiperda Expression Systems Cat# 94-001 Trichuplusia ni cells Expression Systems Cat# 94-002 CHOFlpIn Invitrogen Cat# R75807 Oligonucleotides

    Virus:

    Article Title: Bacteriophage protein PEIP is a potent Bacillus subtilis enolase inhibitor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5a Competent Cells Biomed Cat#BC102-02 E. coli BL21(DE3) Competent Cells Tsingke Cat#TSV-A09 B. subtilis Competent Cells This paper Stain 168 B. subtilis bacteriophage SPO1 BENA Cluture Collection ATCC27370-B1 Chemicals, peptides and recombinant proteins 23TSINGKE Master Mix(green) Tsingke Cat#TSE101 Plasmid Mini Kit Omega Cat#D6943-01 BeyoGel SDS-PAGE Precast Gel Beyotime Cat#P0057A 103TAE buffer Aladdin Cat#T197242 Agarose Biowest Cat#YZQZT Sorbitol Aladdin Cat#S104833 Trehalose Aladdin Cat#T100010 Mannitol Aladdin Cat#M108828 K2HPO4 Aladdin Cat#16788-57-1 KH2PO4 Aladdin Cat#7778-77-0 MgCl2 Aladdin Cat#7786-30-3 Threonine Solarbio Cat#T0012 Glycine Solarbio Cat#G8200 Tween80 Aladdin Cat#T104865 NaCl Aladdin Cat#C111549 Tryptone Aladdin Cat#T139519 Yeast extract Beyotime Cat#ST968 LB medium AOBOX Cat#02-136-y250g Chloramphenicol Aladdin Cat#C100331 Kanamycin Solarbio Cat#K8020 Ampicillin sodium Aladdin Cat#A102050 Glucose Aladdin Cat#921-60-8 Isopropyl-b-D-thiogalactoside Beyotime Cat#ST098 NaH2PO4 Aladdin Cat#7558-80-7 Imidazole Aladdin Cat#I108707 EDTA-Na2 Solarbio Cat#E8030 NiSO4$6H2O Sigma Cat#227676 Precision Plus Protein Dual Color Standards Biorad Cat1610374 53Protein loading buffer Sangon Biotech Cat#C515959-0005 Coomassie brilliant blue Beyotime Cat#P0017F .. Glutaraldehyde MercK Cat#354400 Osmic acid MercK Cat#209104 Uranyl acetate American Custom Chemicals Corporation Cat#CHM0032578 Ethanol MercK Cat#E7023 Acetone MercK Cat#179124 SUMO protease Ulp1 Abbkine Cat#PRP3001 His-tagged PEIP This paper N/A (Continued on next page) Cell Reports 40, 111026, July 5, 2022 e1

    Article Title: Evolving cryo-EM structural approaches for GPCR drug discovery.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Gs C-18 antibody Santa Cruz Cat# sc-383; RRID: AB_631539 mouse poly-His antibody QIAGEN Cat# 34660; RRID: AB_2619735 gp64-PE antibody Thermo Fisher Cat# 12-6991-82; RRID: AB_1633369 IRDye 680RD Goat anti-Mouse IgG LI-COR Cat# LCR-926-68070: RRID: AB_10956588 IRDye 800CW Goat anti-Rabbit IgG LI-COR Cat# LCR-925-32211: RRID: AB_2651127 Bacterial and virus strains Escherichia Coli BL21 ThermoFisher Cat# C600003 Chemicals, peptides, and recombinant proteins PF-06882961 Servier, France N/A ESF 921 serum-free media Expression Systems Cat# 96-001 Opti-MEM I Reduced Serum Medium Thermo Fisher Scientific Cat# 31985088 cOmplete Protease Inhibitor Cocktail tablets Roche Cat# 5056489001 Apyrase NEB Cat# M0398S Lauryl maltose neopentyl glycol Anatrace Cat# NG310 Cholesteryl hemisuccinate Anatrace Cat# CH210 Benzonase Merk Millipore Cat# 71205-3 Flag peptide Sigma-Aldrich Cat# F3290 M1 anti-Flag affinity resin Sigma-Aldrich Cat# A4596 Superdex 200 Increase 10/300 column GE Healthcare Cat# 28990944 Ni-NTA agarose Qiagen Cat# 30230 Anti-Flag M1 ATCC Hybridoma ATCC HB- 259;RRID:CVCL_J730 Amicon Ultra Centrifugal Filter (MWCO, 100 kDa) Merk Millipore UFC910024 TGX Precast Gel BioRad Cat#4561086 Precision Plus Protein Dual Color Standards BioRad Cat# 1610394 Instant Blue Sigma-Aldrich Cat# ISB1L PVDF membrane BioRad Cat# 1620264 FuGENE HD Transfection Reagent Promega Cat# E2311 Critical commercial assays Lance cAMP detection kit PerkinElmer Cat# AD0264 QuikChange site-directed mutagenesis kit Agilent Cat# 200521 Bac to Bac system ThermoFisher Cat# A11098 NanoBRET Nano-Glo substrate Promega Cat#N1572 Coelenterazine H NanoLight Cat#301 Fluo-8 AM Green Fluorescent Calcium binding dye Abcam Cat#142773 Deposited data 200 kV Glacios coordinates This manuscript PDB: 7LCK 200 kV Glacios maps This manuscript EMDB: EMD-23276 300 kV Titan Krios Falcon 4 coordinates This manuscript PDB: 7LCJ 300 kV Titan Krios Falcon 4 maps This manuscript EMDB: EMD-23275 (Continued on next page) Structure 29, 963–974.e1–e6, September 2, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER 300 kV Titan Krios K3 coordinates This manuscript PDB: 7LCI 300 kV Titan Krios K3 maps This manuscript EMDB: EMD-23274 GLP1R:PF 06882961 with Nb35 (Zhang et al., 2020) PDB: 6X1A Experimental models: cell lines Spodoptera frugiperda Expression Systems Cat# 94-001 Trichuplusia ni cells Expression Systems Cat# 94-002 CHOFlpIn Invitrogen Cat# R75807 Oligonucleotides

    SDS Page:

    Article Title: Bacteriophage protein PEIP is a potent Bacillus subtilis enolase inhibitor.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5a Competent Cells Biomed Cat#BC102-02 E. coli BL21(DE3) Competent Cells Tsingke Cat#TSV-A09 B. subtilis Competent Cells This paper Stain 168 B. subtilis bacteriophage SPO1 BENA Cluture Collection ATCC27370-B1 Chemicals, peptides and recombinant proteins 23TSINGKE Master Mix(green) Tsingke Cat#TSE101 Plasmid Mini Kit Omega Cat#D6943-01 BeyoGel SDS-PAGE Precast Gel Beyotime Cat#P0057A 103TAE buffer Aladdin Cat#T197242 Agarose Biowest Cat#YZQZT Sorbitol Aladdin Cat#S104833 Trehalose Aladdin Cat#T100010 Mannitol Aladdin Cat#M108828 K2HPO4 Aladdin Cat#16788-57-1 KH2PO4 Aladdin Cat#7778-77-0 MgCl2 Aladdin Cat#7786-30-3 Threonine Solarbio Cat#T0012 Glycine Solarbio Cat#G8200 Tween80 Aladdin Cat#T104865 NaCl Aladdin Cat#C111549 Tryptone Aladdin Cat#T139519 Yeast extract Beyotime Cat#ST968 LB medium AOBOX Cat#02-136-y250g Chloramphenicol Aladdin Cat#C100331 Kanamycin Solarbio Cat#K8020 Ampicillin sodium Aladdin Cat#A102050 Glucose Aladdin Cat#921-60-8 Isopropyl-b-D-thiogalactoside Beyotime Cat#ST098 NaH2PO4 Aladdin Cat#7558-80-7 Imidazole Aladdin Cat#I108707 EDTA-Na2 Solarbio Cat#E8030 NiSO4$6H2O Sigma Cat#227676 Precision Plus Protein Dual Color Standards Biorad Cat1610374 53Protein loading buffer Sangon Biotech Cat#C515959-0005 Coomassie brilliant blue Beyotime Cat#P0017F .. Glutaraldehyde MercK Cat#354400 Osmic acid MercK Cat#209104 Uranyl acetate American Custom Chemicals Corporation Cat#CHM0032578 Ethanol MercK Cat#E7023 Acetone MercK Cat#179124 SUMO protease Ulp1 Abbkine Cat#PRP3001 His-tagged PEIP This paper N/A (Continued on next page) Cell Reports 40, 111026, July 5, 2022 e1

    Transfection:

    Article Title: Evolving cryo-EM structural approaches for GPCR drug discovery.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Gs C-18 antibody Santa Cruz Cat# sc-383; RRID: AB_631539 mouse poly-His antibody QIAGEN Cat# 34660; RRID: AB_2619735 gp64-PE antibody Thermo Fisher Cat# 12-6991-82; RRID: AB_1633369 IRDye 680RD Goat anti-Mouse IgG LI-COR Cat# LCR-926-68070: RRID: AB_10956588 IRDye 800CW Goat anti-Rabbit IgG LI-COR Cat# LCR-925-32211: RRID: AB_2651127 Bacterial and virus strains Escherichia Coli BL21 ThermoFisher Cat# C600003 Chemicals, peptides, and recombinant proteins PF-06882961 Servier, France N/A ESF 921 serum-free media Expression Systems Cat# 96-001 Opti-MEM I Reduced Serum Medium Thermo Fisher Scientific Cat# 31985088 cOmplete Protease Inhibitor Cocktail tablets Roche Cat# 5056489001 Apyrase NEB Cat# M0398S Lauryl maltose neopentyl glycol Anatrace Cat# NG310 Cholesteryl hemisuccinate Anatrace Cat# CH210 Benzonase Merk Millipore Cat# 71205-3 Flag peptide Sigma-Aldrich Cat# F3290 M1 anti-Flag affinity resin Sigma-Aldrich Cat# A4596 Superdex 200 Increase 10/300 column GE Healthcare Cat# 28990944 Ni-NTA agarose Qiagen Cat# 30230 Anti-Flag M1 ATCC Hybridoma ATCC HB- 259;RRID:CVCL_J730 Amicon Ultra Centrifugal Filter (MWCO, 100 kDa) Merk Millipore UFC910024 TGX Precast Gel BioRad Cat#4561086 Precision Plus Protein Dual Color Standards BioRad Cat# 1610394 Instant Blue Sigma-Aldrich Cat# ISB1L PVDF membrane BioRad Cat# 1620264 FuGENE HD Transfection Reagent Promega Cat# E2311 Critical commercial assays Lance cAMP detection kit PerkinElmer Cat# AD0264 QuikChange site-directed mutagenesis kit Agilent Cat# 200521 Bac to Bac system ThermoFisher Cat# A11098 NanoBRET Nano-Glo substrate Promega Cat#N1572 Coelenterazine H NanoLight Cat#301 Fluo-8 AM Green Fluorescent Calcium binding dye Abcam Cat#142773 Deposited data 200 kV Glacios coordinates This manuscript PDB: 7LCK 200 kV Glacios maps This manuscript EMDB: EMD-23276 300 kV Titan Krios Falcon 4 coordinates This manuscript PDB: 7LCJ 300 kV Titan Krios Falcon 4 maps This manuscript EMDB: EMD-23275 (Continued on next page) Structure 29, 963–974.e1–e6, September 2, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER 300 kV Titan Krios K3 coordinates This manuscript PDB: 7LCI 300 kV Titan Krios K3 maps This manuscript EMDB: EMD-23274 GLP1R:PF 06882961 with Nb35 (Zhang et al., 2020) PDB: 6X1A Experimental models: cell lines Spodoptera frugiperda Expression Systems Cat# 94-001 Trichuplusia ni cells Expression Systems Cat# 94-002 CHOFlpIn Invitrogen Cat# R75807 Oligonucleotides

    Binding Assay:

    Article Title: Evolving cryo-EM structural approaches for GPCR drug discovery.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Gs C-18 antibody Santa Cruz Cat# sc-383; RRID: AB_631539 mouse poly-His antibody QIAGEN Cat# 34660; RRID: AB_2619735 gp64-PE antibody Thermo Fisher Cat# 12-6991-82; RRID: AB_1633369 IRDye 680RD Goat anti-Mouse IgG LI-COR Cat# LCR-926-68070: RRID: AB_10956588 IRDye 800CW Goat anti-Rabbit IgG LI-COR Cat# LCR-925-32211: RRID: AB_2651127 Bacterial and virus strains Escherichia Coli BL21 ThermoFisher Cat# C600003 Chemicals, peptides, and recombinant proteins PF-06882961 Servier, France N/A ESF 921 serum-free media Expression Systems Cat# 96-001 Opti-MEM I Reduced Serum Medium Thermo Fisher Scientific Cat# 31985088 cOmplete Protease Inhibitor Cocktail tablets Roche Cat# 5056489001 Apyrase NEB Cat# M0398S Lauryl maltose neopentyl glycol Anatrace Cat# NG310 Cholesteryl hemisuccinate Anatrace Cat# CH210 Benzonase Merk Millipore Cat# 71205-3 Flag peptide Sigma-Aldrich Cat# F3290 M1 anti-Flag affinity resin Sigma-Aldrich Cat# A4596 Superdex 200 Increase 10/300 column GE Healthcare Cat# 28990944 Ni-NTA agarose Qiagen Cat# 30230 Anti-Flag M1 ATCC Hybridoma ATCC HB- 259;RRID:CVCL_J730 Amicon Ultra Centrifugal Filter (MWCO, 100 kDa) Merk Millipore UFC910024 TGX Precast Gel BioRad Cat#4561086 Precision Plus Protein Dual Color Standards BioRad Cat# 1610394 Instant Blue Sigma-Aldrich Cat# ISB1L PVDF membrane BioRad Cat# 1620264 FuGENE HD Transfection Reagent Promega Cat# E2311 Critical commercial assays Lance cAMP detection kit PerkinElmer Cat# AD0264 QuikChange site-directed mutagenesis kit Agilent Cat# 200521 Bac to Bac system ThermoFisher Cat# A11098 NanoBRET Nano-Glo substrate Promega Cat#N1572 Coelenterazine H NanoLight Cat#301 Fluo-8 AM Green Fluorescent Calcium binding dye Abcam Cat#142773 Deposited data 200 kV Glacios coordinates This manuscript PDB: 7LCK 200 kV Glacios maps This manuscript EMDB: EMD-23276 300 kV Titan Krios Falcon 4 coordinates This manuscript PDB: 7LCJ 300 kV Titan Krios Falcon 4 maps This manuscript EMDB: EMD-23275 (Continued on next page) Structure 29, 963–974.e1–e6, September 2, 2021 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER 300 kV Titan Krios K3 coordinates This manuscript PDB: 7LCI 300 kV Titan Krios K3 maps This manuscript EMDB: EMD-23274 GLP1R:PF 06882961 with Nb35 (Zhang et al., 2020) PDB: 6X1A Experimental models: cell lines Spodoptera frugiperda Expression Systems Cat# 94-001 Trichuplusia ni cells Expression Systems Cat# 94-002 CHOFlpIn Invitrogen Cat# R75807 Oligonucleotides

    other:

    Article Title: Chemotherapy modulation by a cancer-associated microbiota metabolite.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Pierce Restore PLUS Western Blot Stripping Buffer Thermo Fisher Scientific Cat#46430 Agar for C. elegans culture Sigma-Aldrich A7002-5KG Bacto peptone for C. elegans culture BD Difco Cat#211677 NaCl for C. elegans culture Sigma-Aldrich S3014-1KG MgSO 4 for C. elegans culture Fisher M/1050/53 CaCl 2 for C. elegans culture Sigma-Aldrich C3881-1KG Cholesterol Sigma-Aldrich C8667-5G Agar for Drosophila culture Fisher Scientific BP2641-1 Yeast for Drosophila culture MP Biomedicals 903312 Yeast extract for Drosophila culture Sigma 70161 Peptone for Drosophila culture Sigma 82303 Sucrose for Drosophila culture Fisher Scientific S/8600/63 Glucose for Drosophila culture Thermo Scientific 170080025 MgSO4 for Drosophila culture Honeywell Fluka 00627 CaCl2 for Drosophila culture Honeywell Fluka 223506 Propionic acid for Drosophila culture Sigma P1386 Nipagin for Drosophila culture (methyl 4-hydroxybenzoate) Sigma H5501 Ethanol for Drosophila culture Fisher Scientific E/0555DF/17 Columbia Agar Thermo Scientific 11783513 De Man–Rogosa–Sharpe agar Millipore 69966 Defibrinated horse blood Thermo Scientific SR0050C Fastidious Anaerobe Agar Neogen NCM0199C Critical commercial assays GenElute Mammalian Total RNA Miniprep Kit Sigma-Aldrich RTN70 Pierce BCA Protein Assay Kit Thermo Fisher Scientific Cat#23227 GenElute Plasmid MiniPrep Kit Sigma-Aldrich PLN70 IDH activity assay kit Abcam ab102528 MycoAlert testing kit Lonza LT07-318 RT-PCR cDNA Supermix iScript Ready-to-Use cDNA Supermix, 56 reaction kit Cat#1708841 PhosSTOP Roche 4906845001 eBioscience Annexin V-Apoptosis Detection Kit FITC Invitrogen 88-8005-72 FxCycle PI/RNAse Staining Solution Kit Invitrogen F10797 poly-L-Lysine-coated Sigma-Aldrich P4832 Paraformaldehyde Thermo Fisher Scientific Cat# 28906 B-Per lysis buffer Thermo Fisher Scientific Cat#78243 Mitochondrial Stress Test Kit Agilent Cat#103015-100 Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye Thermo Fisher Scientific C10340 cOmplete protease inhibitor cocktail Sigma-Aldrich 11836170001 Deposited data HCT116 cells proteomics This study PRIDE: PXD051364 HCT116, LoVo, DLD-1, SW48, HT29, SW1417 and SK-CO-1 cells RNAseq This study GEO: GSE263706 HCT116 cells targeted metabolomics This study MetaboLights: MTBLS9995 HCT116 cells fluoronucleotides measurements This study MetaboLights: MTBLS9992 (Continued on next page) e4 Cell Systems 16, 101397, September 17, 2025

    Article Title: STAT3-controlled CHI3L1/SPP1 positive feedback loop demonstrates the spatial heterogeneity and immune characteristics of glioblastoma.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Monocle 2 version 2.26.0 Trapnell et al.44 https://cole-trapnell-lab.github.io/ monocle-release/docs/ SingleR version 1.8.0 Aran et al.45 https://github.com/dviraran/SingleR NicheNet version 1.0.0 Browaeys et al.46 https://github.com/saeyslab/nichenetr ST Pipeline version 1.7.2 Navarro et al.47 https://github.com/ SpatialTranscriptomicsResearch/st_pipeline Cell Ranger versions 2.1/3.0 10X Genomics https://www.10xgenomics.com/ ST Spot Detector Wong et al.48 https://github.com/ SpatialTranscriptomicsResearch/st_spot_detector Space Ranger version 1.0.0 10X Genomics https://10xgenomics.com/

    Molecular Weight:

    Article Title: Antagonistic response regulators spatially regulate receptor methylation in the Pseudomonasaeruginosa Pil-Chp surface sensing system.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PAO1 3xFLAG-pilJ DpilG DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP582 PAO1 3xFLAG-pilJ DpilG DchpB this study RP543 PAO1 3xFLAG-pilJ DpilG DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP583 PAO1 3xFLAG-pilJ DpilH this study RP514 PAO1 3xFLAG-pilJ DpilH pUC18_PlacP1-YFP/POXB20-mKate2 this study RP529 PAO1 3xFLAG-pilJ DpilH DcyaB this study RP569 PAO1 3xFLAG-pilJ DpilH DcyaB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP593 PAO1 3xFLAG-pilJ pilHD52A this study RP730 PAO1 3xFLAG-pilJ pilHD52A pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP784 PAO1 3xFLAG-pilJ pilHD52A DcyaB this study RP753 PAO1 3xFLAG-pilJ pilHD52A DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP793 PAO1 3xFLAG-pilJ pilHD52E this study RP738 PAO1 3xFLAG-pilJ pilHD52E pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP788 PAO1 3xFLAG-pilJ pilHD52E DcyaB this study RP757 PAO1 3xFLAG-pilJ pilHD52E DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP795 PAO1 3xFLAG-pilJ DpilH DpilK this study RP563 PAO1 3xFLAG-pilJ DpilH DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP590 PAO1 3xFLAG-pilJ DpilH DchpB this study RP545 PAO1 3xFLAG-pilJ DpilH DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP584 PAO1 3xFLAG-pilJ DpilK pCuAIgent-empty this study RP872 PAO1 3xFLAG-pilJ DpilK pCuAIgent-mNG-pilK this study RP873 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-empty this study RP874 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-mNG-pilK this study RP875 PAO1 3xFLAG-pilG K€uhn et al.24 HM540 PAO1 3xFLAG-pilGD58A K€uhn et al. 24 HM543 PAO1 3xFLAG-pilGD58E K€uhn et al. 24 HM545 BL21(DE3) pH3C-LIC-PilG this study Y955 Nico21(DE3) pH3C-LIC-PilGD58A this study HM681 Nico21(DE3) pH3C-LIC-PilGD58E this study HM683 Chemicals, peptides, and recombinant proteins Acrylamide BioRad Cat # 1610100 Agarose standard Carl Roth Cat # 3810.4 Ampicillin Millipore Sigma Cat # A9518 Beta-mercaptoethanol Millipore Sigma Cat #M3148 Bis-acrylamide crosslinker BioRad Cat # 1610201 Carbenicillin GoldBio Cat # C-103-SL 16% Formaldehyde Solution (w/v), methanol free Thermo Fisher Scientific Cat # 28908 Gentamycin Millipore Sigma Cat #G1914 Glycine Millipore Sigma Cat #G7126 Imidazole Millipore Sigma Cat #I0250 Ionic Detergent Compatibility Reagent for PierceTM 660nm Protein Assay Reagent Thermo Fisher Scientific Cat # 22663 (Continued on next page) Cell Reports 44, 115536, April 22, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER IPTG GoldBio Cat #I2481C Kanamycin sulfate Millipore Sigma Cat #K4000 LB Broth (Luria/Miller) Carl Roth Cat #X968.1 Lysozyme Millipore Sigma Cat #L6876 Non-fat dry milk Lab Scientific bioKEMIX Cat #M0841 Odyssey One-Color Protein Molecular Weight Marker LI-COR Cat # 928-4000 Pierce universal nuclease for cell lysis Thermo Fisher Scientific Cat # 88702 PierceTM 660nm Protein Assay Reagent Thermo Fisher Scientific Cat # 22660 Precision Plus Protein Dual Color Standards BioRad Cat # 1610374 Sodium Chloride Thermo Fisher Scientific Cat #S271-3 Triton X-100 Millipore Sigma Cat #T9284 Tween 20 Fisher Scientific Cat # BP337-500 Oligonucleotides CAT GCC TGC AGG TCG ACT GCA CGC TCG GCC TGT TCC Generation of pMK14 and pMK15 oMK119 GGA AAC GGC CTG TTC CAT GTT CGC CCT ATA TCG AC Generation of pMK14 and pMK15 oMK120 ATG GAA CAG GCC GTT TCC TGA TAT CCG GCC Generation of pMK14 and pMK15 oMK121 GCT ATG ACC ATG ATT ACG CCG CTC CAG CTC TGC ACC Generation of pMK14 and pMK15 oMK122 .. REAGENT or RESOURCE SOURCE IDENTIFIER PAO1 3xFLAG-pilJ DpilG DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP582 PAO1 3xFLAG-pilJ DpilG DchpB this study RP543 PAO1 3xFLAG-pilJ DpilG DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP583 PAO1 3xFLAG-pilJ DpilH this study RP514 PAO1 3xFLAG-pilJ DpilH pUC18_PlacP1-YFP/POXB20-mKate2 this study RP529 PAO1 3xFLAG-pilJ DpilH DcyaB this study RP569 PAO1 3xFLAG-pilJ DpilH DcyaB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP593 PAO1 3xFLAG-pilJ pilHD52A this study RP730 PAO1 3xFLAG-pilJ pilHD52A pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP784 PAO1 3xFLAG-pilJ pilHD52A DcyaB this study RP753 PAO1 3xFLAG-pilJ pilHD52A DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP793 PAO1 3xFLAG-pilJ pilHD52E this study RP738 PAO1 3xFLAG-pilJ pilHD52E pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP788 PAO1 3xFLAG-pilJ pilHD52E DcyaB this study RP757 PAO1 3xFLAG-pilJ pilHD52E DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP795 PAO1 3xFLAG-pilJ DpilH DpilK this study RP563 PAO1 3xFLAG-pilJ DpilH DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP590 PAO1 3xFLAG-pilJ DpilH DchpB this study RP545 PAO1 3xFLAG-pilJ DpilH DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP584 PAO1 3xFLAG-pilJ DpilK pCuAIgent-empty this study RP872 PAO1 3xFLAG-pilJ DpilK pCuAIgent-mNG-pilK this study RP873 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-empty this study RP874 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-mNG-pilK this study RP875 PAO1 3xFLAG-pilG K€uhn et al.24 HM540 PAO1 3xFLAG-pilGD58A K€uhn et al. 24 HM543 PAO1 3xFLAG-pilGD58E K€uhn et al. 24 HM545 BL21(DE3) pH3C-LIC-PilG this study Y955 Nico21(DE3) pH3C-LIC-PilGD58A this study HM681 Nico21(DE3) pH3C-LIC-PilGD58E this study HM683 Chemicals, peptides, and recombinant proteins Acrylamide BioRad Cat # 1610100 Agarose standard Carl Roth Cat # 3810.4 Ampicillin Millipore Sigma Cat # A9518 Beta-mercaptoethanol Millipore Sigma Cat #M3148 Bis-acrylamide crosslinker BioRad Cat # 1610201 Carbenicillin GoldBio Cat # C-103-SL 16% Formaldehyde Solution (w/v), methanol free Thermo Fisher Scientific Cat # 28908 Gentamycin Millipore Sigma Cat #G1914 Glycine Millipore Sigma Cat #G7126 Imidazole Millipore Sigma Cat #I0250 Ionic Detergent Compatibility Reagent for PierceTM 660nm Protein Assay Reagent Thermo Fisher Scientific Cat # 22663 (Continued on next page) Cell Reports 44, 115536, April 22, 2025 19

    Marker:

    Article Title: Antagonistic response regulators spatially regulate receptor methylation in the Pseudomonasaeruginosa Pil-Chp surface sensing system.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PAO1 3xFLAG-pilJ DpilG DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP582 PAO1 3xFLAG-pilJ DpilG DchpB this study RP543 PAO1 3xFLAG-pilJ DpilG DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP583 PAO1 3xFLAG-pilJ DpilH this study RP514 PAO1 3xFLAG-pilJ DpilH pUC18_PlacP1-YFP/POXB20-mKate2 this study RP529 PAO1 3xFLAG-pilJ DpilH DcyaB this study RP569 PAO1 3xFLAG-pilJ DpilH DcyaB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP593 PAO1 3xFLAG-pilJ pilHD52A this study RP730 PAO1 3xFLAG-pilJ pilHD52A pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP784 PAO1 3xFLAG-pilJ pilHD52A DcyaB this study RP753 PAO1 3xFLAG-pilJ pilHD52A DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP793 PAO1 3xFLAG-pilJ pilHD52E this study RP738 PAO1 3xFLAG-pilJ pilHD52E pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP788 PAO1 3xFLAG-pilJ pilHD52E DcyaB this study RP757 PAO1 3xFLAG-pilJ pilHD52E DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP795 PAO1 3xFLAG-pilJ DpilH DpilK this study RP563 PAO1 3xFLAG-pilJ DpilH DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP590 PAO1 3xFLAG-pilJ DpilH DchpB this study RP545 PAO1 3xFLAG-pilJ DpilH DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP584 PAO1 3xFLAG-pilJ DpilK pCuAIgent-empty this study RP872 PAO1 3xFLAG-pilJ DpilK pCuAIgent-mNG-pilK this study RP873 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-empty this study RP874 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-mNG-pilK this study RP875 PAO1 3xFLAG-pilG K€uhn et al.24 HM540 PAO1 3xFLAG-pilGD58A K€uhn et al. 24 HM543 PAO1 3xFLAG-pilGD58E K€uhn et al. 24 HM545 BL21(DE3) pH3C-LIC-PilG this study Y955 Nico21(DE3) pH3C-LIC-PilGD58A this study HM681 Nico21(DE3) pH3C-LIC-PilGD58E this study HM683 Chemicals, peptides, and recombinant proteins Acrylamide BioRad Cat # 1610100 Agarose standard Carl Roth Cat # 3810.4 Ampicillin Millipore Sigma Cat # A9518 Beta-mercaptoethanol Millipore Sigma Cat #M3148 Bis-acrylamide crosslinker BioRad Cat # 1610201 Carbenicillin GoldBio Cat # C-103-SL 16% Formaldehyde Solution (w/v), methanol free Thermo Fisher Scientific Cat # 28908 Gentamycin Millipore Sigma Cat #G1914 Glycine Millipore Sigma Cat #G7126 Imidazole Millipore Sigma Cat #I0250 Ionic Detergent Compatibility Reagent for PierceTM 660nm Protein Assay Reagent Thermo Fisher Scientific Cat # 22663 (Continued on next page) Cell Reports 44, 115536, April 22, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER IPTG GoldBio Cat #I2481C Kanamycin sulfate Millipore Sigma Cat #K4000 LB Broth (Luria/Miller) Carl Roth Cat #X968.1 Lysozyme Millipore Sigma Cat #L6876 Non-fat dry milk Lab Scientific bioKEMIX Cat #M0841 Odyssey One-Color Protein Molecular Weight Marker LI-COR Cat # 928-4000 Pierce universal nuclease for cell lysis Thermo Fisher Scientific Cat # 88702 PierceTM 660nm Protein Assay Reagent Thermo Fisher Scientific Cat # 22660 Precision Plus Protein Dual Color Standards BioRad Cat # 1610374 Sodium Chloride Thermo Fisher Scientific Cat #S271-3 Triton X-100 Millipore Sigma Cat #T9284 Tween 20 Fisher Scientific Cat # BP337-500 Oligonucleotides CAT GCC TGC AGG TCG ACT GCA CGC TCG GCC TGT TCC Generation of pMK14 and pMK15 oMK119 GGA AAC GGC CTG TTC CAT GTT CGC CCT ATA TCG AC Generation of pMK14 and pMK15 oMK120 ATG GAA CAG GCC GTT TCC TGA TAT CCG GCC Generation of pMK14 and pMK15 oMK121 GCT ATG ACC ATG ATT ACG CCG CTC CAG CTC TGC ACC Generation of pMK14 and pMK15 oMK122 .. REAGENT or RESOURCE SOURCE IDENTIFIER PAO1 3xFLAG-pilJ DpilG DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP582 PAO1 3xFLAG-pilJ DpilG DchpB this study RP543 PAO1 3xFLAG-pilJ DpilG DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP583 PAO1 3xFLAG-pilJ DpilH this study RP514 PAO1 3xFLAG-pilJ DpilH pUC18_PlacP1-YFP/POXB20-mKate2 this study RP529 PAO1 3xFLAG-pilJ DpilH DcyaB this study RP569 PAO1 3xFLAG-pilJ DpilH DcyaB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP593 PAO1 3xFLAG-pilJ pilHD52A this study RP730 PAO1 3xFLAG-pilJ pilHD52A pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP784 PAO1 3xFLAG-pilJ pilHD52A DcyaB this study RP753 PAO1 3xFLAG-pilJ pilHD52A DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP793 PAO1 3xFLAG-pilJ pilHD52E this study RP738 PAO1 3xFLAG-pilJ pilHD52E pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP788 PAO1 3xFLAG-pilJ pilHD52E DcyaB this study RP757 PAO1 3xFLAG-pilJ pilHD52E DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP795 PAO1 3xFLAG-pilJ DpilH DpilK this study RP563 PAO1 3xFLAG-pilJ DpilH DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP590 PAO1 3xFLAG-pilJ DpilH DchpB this study RP545 PAO1 3xFLAG-pilJ DpilH DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP584 PAO1 3xFLAG-pilJ DpilK pCuAIgent-empty this study RP872 PAO1 3xFLAG-pilJ DpilK pCuAIgent-mNG-pilK this study RP873 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-empty this study RP874 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-mNG-pilK this study RP875 PAO1 3xFLAG-pilG K€uhn et al.24 HM540 PAO1 3xFLAG-pilGD58A K€uhn et al. 24 HM543 PAO1 3xFLAG-pilGD58E K€uhn et al. 24 HM545 BL21(DE3) pH3C-LIC-PilG this study Y955 Nico21(DE3) pH3C-LIC-PilGD58A this study HM681 Nico21(DE3) pH3C-LIC-PilGD58E this study HM683 Chemicals, peptides, and recombinant proteins Acrylamide BioRad Cat # 1610100 Agarose standard Carl Roth Cat # 3810.4 Ampicillin Millipore Sigma Cat # A9518 Beta-mercaptoethanol Millipore Sigma Cat #M3148 Bis-acrylamide crosslinker BioRad Cat # 1610201 Carbenicillin GoldBio Cat # C-103-SL 16% Formaldehyde Solution (w/v), methanol free Thermo Fisher Scientific Cat # 28908 Gentamycin Millipore Sigma Cat #G1914 Glycine Millipore Sigma Cat #G7126 Imidazole Millipore Sigma Cat #I0250 Ionic Detergent Compatibility Reagent for PierceTM 660nm Protein Assay Reagent Thermo Fisher Scientific Cat # 22663 (Continued on next page) Cell Reports 44, 115536, April 22, 2025 19

    Lysis:

    Article Title: Antagonistic response regulators spatially regulate receptor methylation in the Pseudomonasaeruginosa Pil-Chp surface sensing system.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PAO1 3xFLAG-pilJ DpilG DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP582 PAO1 3xFLAG-pilJ DpilG DchpB this study RP543 PAO1 3xFLAG-pilJ DpilG DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP583 PAO1 3xFLAG-pilJ DpilH this study RP514 PAO1 3xFLAG-pilJ DpilH pUC18_PlacP1-YFP/POXB20-mKate2 this study RP529 PAO1 3xFLAG-pilJ DpilH DcyaB this study RP569 PAO1 3xFLAG-pilJ DpilH DcyaB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP593 PAO1 3xFLAG-pilJ pilHD52A this study RP730 PAO1 3xFLAG-pilJ pilHD52A pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP784 PAO1 3xFLAG-pilJ pilHD52A DcyaB this study RP753 PAO1 3xFLAG-pilJ pilHD52A DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP793 PAO1 3xFLAG-pilJ pilHD52E this study RP738 PAO1 3xFLAG-pilJ pilHD52E pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP788 PAO1 3xFLAG-pilJ pilHD52E DcyaB this study RP757 PAO1 3xFLAG-pilJ pilHD52E DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP795 PAO1 3xFLAG-pilJ DpilH DpilK this study RP563 PAO1 3xFLAG-pilJ DpilH DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP590 PAO1 3xFLAG-pilJ DpilH DchpB this study RP545 PAO1 3xFLAG-pilJ DpilH DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP584 PAO1 3xFLAG-pilJ DpilK pCuAIgent-empty this study RP872 PAO1 3xFLAG-pilJ DpilK pCuAIgent-mNG-pilK this study RP873 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-empty this study RP874 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-mNG-pilK this study RP875 PAO1 3xFLAG-pilG K€uhn et al.24 HM540 PAO1 3xFLAG-pilGD58A K€uhn et al. 24 HM543 PAO1 3xFLAG-pilGD58E K€uhn et al. 24 HM545 BL21(DE3) pH3C-LIC-PilG this study Y955 Nico21(DE3) pH3C-LIC-PilGD58A this study HM681 Nico21(DE3) pH3C-LIC-PilGD58E this study HM683 Chemicals, peptides, and recombinant proteins Acrylamide BioRad Cat # 1610100 Agarose standard Carl Roth Cat # 3810.4 Ampicillin Millipore Sigma Cat # A9518 Beta-mercaptoethanol Millipore Sigma Cat #M3148 Bis-acrylamide crosslinker BioRad Cat # 1610201 Carbenicillin GoldBio Cat # C-103-SL 16% Formaldehyde Solution (w/v), methanol free Thermo Fisher Scientific Cat # 28908 Gentamycin Millipore Sigma Cat #G1914 Glycine Millipore Sigma Cat #G7126 Imidazole Millipore Sigma Cat #I0250 Ionic Detergent Compatibility Reagent for PierceTM 660nm Protein Assay Reagent Thermo Fisher Scientific Cat # 22663 (Continued on next page) Cell Reports 44, 115536, April 22, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER IPTG GoldBio Cat #I2481C Kanamycin sulfate Millipore Sigma Cat #K4000 LB Broth (Luria/Miller) Carl Roth Cat #X968.1 Lysozyme Millipore Sigma Cat #L6876 Non-fat dry milk Lab Scientific bioKEMIX Cat #M0841 Odyssey One-Color Protein Molecular Weight Marker LI-COR Cat # 928-4000 Pierce universal nuclease for cell lysis Thermo Fisher Scientific Cat # 88702 PierceTM 660nm Protein Assay Reagent Thermo Fisher Scientific Cat # 22660 Precision Plus Protein Dual Color Standards BioRad Cat # 1610374 Sodium Chloride Thermo Fisher Scientific Cat #S271-3 Triton X-100 Millipore Sigma Cat #T9284 Tween 20 Fisher Scientific Cat # BP337-500 Oligonucleotides CAT GCC TGC AGG TCG ACT GCA CGC TCG GCC TGT TCC Generation of pMK14 and pMK15 oMK119 GGA AAC GGC CTG TTC CAT GTT CGC CCT ATA TCG AC Generation of pMK14 and pMK15 oMK120 ATG GAA CAG GCC GTT TCC TGA TAT CCG GCC Generation of pMK14 and pMK15 oMK121 GCT ATG ACC ATG ATT ACG CCG CTC CAG CTC TGC ACC Generation of pMK14 and pMK15 oMK122 .. REAGENT or RESOURCE SOURCE IDENTIFIER PAO1 3xFLAG-pilJ DpilG DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP582 PAO1 3xFLAG-pilJ DpilG DchpB this study RP543 PAO1 3xFLAG-pilJ DpilG DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP583 PAO1 3xFLAG-pilJ DpilH this study RP514 PAO1 3xFLAG-pilJ DpilH pUC18_PlacP1-YFP/POXB20-mKate2 this study RP529 PAO1 3xFLAG-pilJ DpilH DcyaB this study RP569 PAO1 3xFLAG-pilJ DpilH DcyaB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP593 PAO1 3xFLAG-pilJ pilHD52A this study RP730 PAO1 3xFLAG-pilJ pilHD52A pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP784 PAO1 3xFLAG-pilJ pilHD52A DcyaB this study RP753 PAO1 3xFLAG-pilJ pilHD52A DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP793 PAO1 3xFLAG-pilJ pilHD52E this study RP738 PAO1 3xFLAG-pilJ pilHD52E pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP788 PAO1 3xFLAG-pilJ pilHD52E DcyaB this study RP757 PAO1 3xFLAG-pilJ pilHD52E DcyaB pUC18_PlacP1-YFP/POXB20-mKate2 this study RP795 PAO1 3xFLAG-pilJ DpilH DpilK this study RP563 PAO1 3xFLAG-pilJ DpilH DpilK pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP590 PAO1 3xFLAG-pilJ DpilH DchpB this study RP545 PAO1 3xFLAG-pilJ DpilH DchpB pUC18_ PlacP1-YFP/POXB20-mKate2 this study RP584 PAO1 3xFLAG-pilJ DpilK pCuAIgent-empty this study RP872 PAO1 3xFLAG-pilJ DpilK pCuAIgent-mNG-pilK this study RP873 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-empty this study RP874 PAO1 3xFLAG-pilJ DpilK DchpB pCuAIgent-mNG-pilK this study RP875 PAO1 3xFLAG-pilG K€uhn et al.24 HM540 PAO1 3xFLAG-pilGD58A K€uhn et al. 24 HM543 PAO1 3xFLAG-pilGD58E K€uhn et al. 24 HM545 BL21(DE3) pH3C-LIC-PilG this study Y955 Nico21(DE3) pH3C-LIC-PilGD58A this study HM681 Nico21(DE3) pH3C-LIC-PilGD58E this study HM683 Chemicals, peptides, and recombinant proteins Acrylamide BioRad Cat # 1610100 Agarose standard Carl Roth Cat # 3810.4 Ampicillin Millipore Sigma Cat # A9518 Beta-mercaptoethanol Millipore Sigma Cat #M3148 Bis-acrylamide crosslinker BioRad Cat # 1610201 Carbenicillin GoldBio Cat # C-103-SL 16% Formaldehyde Solution (w/v), methanol free Thermo Fisher Scientific Cat # 28908 Gentamycin Millipore Sigma Cat #G1914 Glycine Millipore Sigma Cat #G7126 Imidazole Millipore Sigma Cat #I0250 Ionic Detergent Compatibility Reagent for PierceTM 660nm Protein Assay Reagent Thermo Fisher Scientific Cat # 22663 (Continued on next page) Cell Reports 44, 115536, April 22, 2025 19



    Similar Products

    97
    Bio-Rad biorad protein marker
    Biorad Protein Marker, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/precision+plus+protein+dual+color+standards+biorad/Precision+Plus+Protein+Dual+Color+Standards/pm41376883-96-13-13
    Average 97 stars, based on 1 article reviews
    biorad protein marker - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Bio-Rad biorad precision plus dual color ladder
    Biorad Precision Plus Dual Color Ladder, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/precision+plus+protein+dual+color+standards+biorad/Precision+Plus+Protein+Dual+Color+Standards/us12448399-2383-99-98
    Average 97 stars, based on 1 article reviews
    biorad precision plus dual color ladder - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Bio-Rad biorad laboratories cat
    Biorad Laboratories Cat, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/precision+plus+protein+dual+color+standards+biorad/Precision+Plus+Protein+Dual+Color+Standards/pmc12445495__pone%2E0332065%2Es001-300-0-0
    Average 97 stars, based on 1 article reviews
    biorad laboratories cat - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Bio-Rad precision plus protein dual color standards biorad
    Precision Plus Protein Dual Color Standards Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/precision+plus+protein+dual+color+standards+biorad/Precision+Plus+Protein+Dual+Color+Standards/pm40934913-315-226-232
    Average 97 stars, based on 1 article reviews
    precision plus protein dual color standards biorad - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Bio-Rad biorad catalog no 1610374
    Biorad Catalog No 1610374, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/precision+plus+protein+dual+color+standards+biorad/Precision+Plus+Protein+Dual+Color+Standards/bio_rxiv__2025__08__03__668358-403-9-9
    Average 97 stars, based on 1 article reviews
    biorad catalog no 1610374 - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Bio-Rad color biorad precision plus protein dual color standards catalog 1610374
    Color Biorad Precision Plus Protein Dual Color Standards Catalog 1610374, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/precision+plus+protein+dual+color+standards+biorad/Precision+Plus+Protein+Dual+Color+Standards/pm40052925__ja5c00386_si_001-61-8-9
    Average 97 stars, based on 1 article reviews
    color biorad precision plus protein dual color standards catalog 1610374 - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    Image Search Results